Top » Catalog » SNPs » M10667

$18.00

M10667
[M10667]

M10667
hg38 Position: ChrY:14792318..14792318
Ancestral: C
Derived: T
Reference: Underhill et al (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: M10667_F GCAGGCCTTCAGTCATGG
Reverse Primer: M10667_R GTGGATTTCTGAATTGAGAAGTGG
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
BY16791
BY16791
FT49600
FT49600
FGC5
FGC5
FGC4415
FGC4415
ZS9200
ZS9200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies