Top » Catalog » SNPs » A4697

$18.00

A4697
[A4697]

A4697
hg38 Position: ChrY:12339958..12339958
Ancestral: C
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1a1a (not listed)
Comments: Downstream DF97
Forward Primer: A4697_F GAGAAATTGAGATACTCGGGGG
Reverse Primer: A4697_R GAAAGGAAATTGAATTACGTATGTATTTAC
Reviews

Customers who bought this product also purchased
A259
A259
Z29319
Z29319
DF85
DF85
A1330
A1330
S588
S588
FGC19845
FGC19845
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies