Top » Catalog » SNPs » A4697

$18.00

A4697
[A4697]

A4697
hg38 Position: ChrY:12339958..12339958
Ancestral: C
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1a1a (not listed)
Comments: Downstream DF97
Forward Primer: A4697_F GAGAAATTGAGATACTCGGGGG
Reverse Primer: A4697_R GAAAGGAAATTGAATTACGTATGTATTTAC
Reviews

Customers who bought this product also purchased
M222
M222
DF97
DF97
FGC19851
FGC19851
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
Z29319
Z29319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies