Top » Catalog » SNPs » FT65952

$18.00

FT65952
[FT65952]

FT65952
hg38 Position: ChrY:15519650..15519650
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT65952_F CATGCAGTGAATGTTATAGCTCTG
Reverse Primer: FT65952_R GAGAGGCCACTGCAGGTG
Reviews

Customers who bought this product also purchased
A356
A356
FT14506
FT14506
BY153567
BY153567
PH908
PH908
A22312
A22312
S17250
S17250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies