Top » Catalog » SNPs » FGC54321

$18.00

FGC54321
[FGC54321]

FGC54321
hg38 Position: ChrY:21032900..21032900
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54321_F GGAACCATCAAAATGAATAAATATCTG
Reverse Primer: FGC54321_R GGCTGCCCATCACCAAG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC12
FGC12
FGC3722
FGC3722
FGC8712
FGC8712
FGC3718
FGC3718
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies