Top » Catalog » SNPs » FGC54321

$18.00

FGC54321
[FGC54321]

FGC54321
hg38 Position: ChrY:21032900..21032900
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54321_F GGAACCATCAAAATGAATAAATATCTG
Reverse Primer: FGC54321_R GGCTGCCCATCACCAAG
Reviews

Customers who bought this product also purchased
B237
B237
CTS10177
CTS10177
FGC1696
FGC1696
Z18258
Z18258
ZS9734
ZS9734
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies