Top » Catalog » SNPs » Y144305

$18.00

Y144305
[Y144305]

Y144305
hg38 Position: ChrY:9993818..9993818
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y144305_F GCACAACAAAGAGACAGAGACG
Reverse Primer: Y144305_R AAGAAGACGAAGAGGTTGCG
Reviews

Customers who bought this product also purchased
FT34699
FT34699
BY171434
BY171434
FT34788
FT34788
BY153567
BY153567
Y81557
Y81557
Y15928
Y15928
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies