Top » Catalog » SNPs » Z2336

$18.00

Z2336
[Z2336]

Z2336
hg38 Position: ChrY:14738899..14738899
Ancestral: A
Derived: T
Reference: Ken Nordtvedt (2012)
ISOGG Haplogroup: I1a1
Comments: Aka CTS6364
Forward Primer: Z2336_F CAGTTGGGGAGTTTGCAATAG
Reverse Primer: Z2336_R TCACACAGCTGCACACCAG
Reviews

Customers who bought this product also purchased
S10908
S10908
A14157
A14157
S244
S244
S10066
S10066
FGC15560
FGC15560
Y11205
Y11205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies