Top » Catalog » SNPs » Z2336

$18.00

Z2336
[Z2336]

Z2336
hg38 Position: ChrY:14738899..14738899
Ancestral: A
Derived: T
Reference: Ken Nordtvedt (2012)
ISOGG Haplogroup: I1a1
Comments: Aka CTS6364
Forward Primer: Z2336_F CAGTTGGGGAGTTTGCAATAG
Reverse Primer: Z2336_R TCACACAGCTGCACACCAG
Reviews

Customers who bought this product also purchased
Z2539
Z2539
A196
A196
YP1084
YP1084
Y23688
Y23688
F2642
F2642
Y7477
Y7477
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies