Top » Catalog » SNPs » Z2336

$18.00

Z2336
[Z2336]

Z2336
hg38 Position: ChrY:14738899..14738899
Ancestral: A
Derived: T
Reference: Ken Nordtvedt (2012)
ISOGG Haplogroup: I1a1
Comments: Aka CTS6364
Forward Primer: Z2336_F CAGTTGGGGAGTTTGCAATAG
Reverse Primer: Z2336_R TCACACAGCTGCACACCAG
Reviews

Customers who bought this product also purchased
Y46501
Y46501
A11280
A11280
A11278
A11278
Y49719
Y49719
PH1237
PH1237
Y177575
Y177575
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies