Top » Catalog » SNPs » FT117124

$18.00

FT117124
[FT117124]

FT117124
hg38 Position: ChrY:13404177..13404177
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT117124_F TCAATGTAGACTTTGAGCTTGGTC
Reverse Primer: FT117124_R TTTTGGGCCCTTAACAGATG
Reviews (1)

Customers who bought this product also purchased
FT119458
FT119458
FT118443
FT118443
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies