Top » Catalog » SNPs » FT119458

$18.00

FT119458
[FT119458]

FT119458
hg38 Position: ChrY:20568995..20568995
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT119458_F CAATACTAAGAAAAAAGAAGAAAGCCA
Reverse Primer: FT119458_R ATGCAGCTGCTTTTGCATC
Reviews (1)

Customers who bought this product also purchased
FT118443
FT118443
FT117124
FT117124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT119458
$18.00
Haplogroup Info
Other products
Currencies