Top » Catalog » SNPs » Y150648

$18.00

Y150648
[Y150648]

Y150648
hg38 Position: ChrY:13004681..13004681
Ancestral: T
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below YP618 > YP992
Forward Primer: Y150648_F TCCCTTTCATAGCCAAGCAG
Reverse Primer: Y150648_R AAGCTGCAGAACAGCGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies