Top » Catalog » SNPs » FT65956

$18.00

FT65956
[FT65956]

FT65956
hg38 Position: ChrY:17431315..17431315
Ancestral: T
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT65956_F TCTCCAAAAAAGATGCTAAGGG
Reverse Primer: FT65956_R CAAAGGTGGGAGAACAACTTCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies