Top » Catalog » SNPs » FT46689

$18.00

FT46689
[FT46689]

FT46689
hg38 Position: ChrY:19372893..19372893
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT46689_F TTTTTTCTTTAAGACCACTTGTATTCAG
Reverse Primer: FT46689_R ATCTCACCTCAGTTAAAATAGCTTTTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies