Top » Catalog » SNPs » BY16787

$18.00

BY16787
[BY16787]

BY16787
hg38 Position: ChrY:16607063..16607063
Ancestral: C
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF21 > L130 > BY3308
Forward Primer: BY16787_F GGGGACACAAACATTTTATGC
Reverse Primer: BY16787_R GCCACCTTATTTCTAAAGACAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies