Top » Catalog » SNPs » FT138628

$18.00

FT138628
[FT138628]

FT138628
hg38 Position: ChrY:12821371..12821371
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2a
Comments: Below S17250 > PH908
Forward Primer: FT138628_F TCTTCTTCCTACCCCGACAAC
Reverse Primer: FT138628_R TTCTACAGGGGCTTTGGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies