Top » Catalog » SNPs » FT138628

$18.00

FT138628
[FT138628]

FT138628
hg38 Position: ChrY:12821371..12821371
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2a
Comments: Below S17250 > PH908
Forward Primer: FT138628_F TCTTCTTCCTACCCCGACAAC
Reverse Primer: FT138628_R TTCTACAGGGGCTTTGGAAAC
Reviews

Customers who bought this product also purchased
Z2582
Z2582
M173
M173
BY97555
BY97555
BY131900
BY131900
F3145
F3145
M438
M438
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies