Top » Catalog » SNPs » S916

$18.00

S916
[S916]

S916
hg38 Position: ChrY:20028658..20028658
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: Observed in J-ZS1297 and R-S16027
Forward Primer: S916_F CCAAGCAGTCAAAGCAATTC
Reverse Primer: S916_R AAATGTACTGCAACGAACACATTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies