Top » Catalog » SNPs » FGC19487

$18.00

FGC19487
[FGC19487]

FGC19487
hg38 Position: ChrY:15204385..15204385
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC7 > Y10964
Forward Primer: FGC19487_F GTCAGTTTATTGGGAAGTACACAGTTC
Reverse Primer: FGC19487_R GACCCCAAACTCACTAAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies