Top » Catalog » SNPs » Z4133

$18.00

Z4133
[Z4133]

Z4133
hg38 Position: ChrY:20415764..20415764
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: C2
Comments: Observed in C-M217 and below J2-Z40052
Forward Primer: Z4133_F AAAGTCATTTTAAGTGGAGAGAGATAATAAG
Reverse Primer: Z4133_R GAAAACATATGGAAAACTCTCCCA
Reviews

Customers who bought this product also purchased
BY75735
BY75735
Z2432
Z2432
Z40054
Z40054
Z638
Z638
Z40052
Z40052
M241
M241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies