Top » Catalog » SNPs » Z4133

$18.00

Z4133
[Z4133]

Z4133
hg38 Position: ChrY:20415764..20415764
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: C2
Comments: Observed in C-M217 and below J2-Z40052
Forward Primer: Z4133_F AAAGTCATTTTAAGTGGAGAGAGATAATAAG
Reverse Primer: Z4133_R GAAAACATATGGAAAACTCTCCCA
Reviews

Customers who bought this product also purchased
Z638
Z638
Z40052
Z40052
M241
M241
PH1602
PH1602
FT63279
FT63279
J2b-M12 Panel
J2b-M12 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies