Top » Catalog » SNPs » ZS4365

$18.00

ZS4365
[ZS4365]

ZS4365
hg38 Position: ChrY:19774944..19774944
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC8223 > CTS5332
Forward Primer: ZS4365_F GTTACCTGGCAGTGGTAGTCACTAG
Reverse Primer: ZS4365_R CAGTAGTTGTCATTTAATAGTGAGAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies