Top » Catalog » SNPs » ZS4360

$18.00

ZS4360
[ZS4360]

ZS4360
hg38 Position: ChrY:19270513..19270513
Ancestral: A
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC8223 > CTS5332
Forward Primer: ZS4360_F AATTTATCTTGGGCTTGCAGC
Reverse Primer: ZS4360_R GCTTAAGCCCACTTACCCAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies