Top » Catalog » SNPs » A25453

$18.00

A25453
[A25453]

A25453
hg38 Position: ChrY:7477687..7477687
Ancestral: T
Derived: C
Reference: Petr Soucek (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A25453_F GTGACAGTCTATGTCTCTTTGTAAGTCTG
Reverse Primer: A25453_R GGGCAAAATAACCAGCTAACATTAC
Reviews

Customers who bought this product also purchased
Y177949
Y177949
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies