Top » Catalog » SNPs » FT151060

$18.00

FT151060
[FT151060]

FT151060
hg38 Position: ChrY:12815312..12815312
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z255 > Z16429 > Z16433 > A430
Forward Primer: FT151060_F TTTTGAGAGGGAGTCTTGGC
Reverse Primer: FT151060_R AGTGAAAATACAAAAGTTAGCTGAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies