Top » Catalog » SNPs » A24226

$18.00

A24226
[A24226]

A24226
hg38 Position: ChrY:13534001..13534001
Ancestral: C
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24226_F TGACTTCTTTCTGGTTTAGTCTAGGC
Reverse Primer: A24226_R TCTCAGCACCACATCCCAG
Reviews

Customers who bought this product also purchased
A24249
A24249
A24243
A24243
A24248
A24248
A24218
A24218
A24247
A24247
A24232
A24232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies