Top » Catalog » SNPs » A24226

$18.00

A24226
[A24226]

A24226
hg38 Position: ChrY:13534001..13534001
Ancestral: C
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24226_F TGACTTCTTTCTGGTTTAGTCTAGGC
Reverse Primer: A24226_R TCTCAGCACCACATCCCAG
Reviews

Customers who bought this product also purchased
A24232
A24232
A24246
A24246
YSEQ-Alpha
YSEQ-Alpha
A24245
A24245
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A24244
A24244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies