Top » Catalog » SNPs » A24243

$18.00

A24243
[A24243]

A24243
hg38 Position: ChrY:6829098..6829098
Ancestral: A
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24243_F AATGCTGGCATTAATGACCTG
Reverse Primer: A24243_R CCTTTTATGGCCTGATCCG
Reviews

Customers who bought this product also purchased
A24245
A24245
Whole Genome Sequence
Whole Genome Sequence
A24244
A24244
A24249
A24249
A24226
A24226
A24248
A24248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies