Top » Catalog » SNPs » A24244

$18.00

A24244
[A24244]

A24244
hg38 Position: ChrY:7738920..7738920
Ancestral: C
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24244_F CCAGAACATCCCAATGTCTCC
Reverse Primer: A24244_R GAACATTTGCTCTTCCCTGAG
Reviews

Customers who bought this product also purchased
A24232
A24232
A24246
A24246
YSEQ-Alpha
YSEQ-Alpha
A24245
A24245
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A24243
A24243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies