Top » Catalog » SNPs » A24244

$18.00

A24244
[A24244]

A24244
hg38 Position: ChrY:7738920..7738920
Ancestral: C
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24244_F CCAGAACATCCCAATGTCTCC
Reverse Primer: A24244_R GAACATTTGCTCTTCCCTGAG
Reviews

Customers who bought this product also purchased
A24232
A24232
A24246
A24246
YSEQ-Alpha
YSEQ-Alpha
A24245
A24245
Whole Genome Sequence
Whole Genome Sequence
A24243
A24243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies