Top » Catalog » SNPs » A24245

$18.00

A24245
[A24245]

A24245
hg38 Position: ChrY:8360939..8360939
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24245_F CACCATTCTTGCTAAGCATGATC
Reverse Primer: A24245_R GGTTCAACTCACATGCACTAATATAACTC
Reviews

Customers who bought this product also purchased
A24218
A24218
A24247
A24247
A24232
A24232
A24246
A24246
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies