Top » Catalog » SNPs » A24245

$18.00

A24245
[A24245]

A24245
hg38 Position: ChrY:8360939..8360939
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24245_F CACCATTCTTGCTAAGCATGATC
Reverse Primer: A24245_R GGTTCAACTCACATGCACTAATATAACTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Whole Genome Sequence
Whole Genome Sequence
A24243
A24243
A24249
A24249
A24226
A24226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies