Top » Catalog » SNPs » A24246

$18.00

A24246
[A24246]

A24246
hg38 Position: ChrY:12829319..12829319
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24246_F AATTTGGGAAAGGAAATGATCC
Reverse Primer: A24246_R GTATATGGCTTTCCTTTTGATGAAG
Reviews

Customers who bought this product also purchased
A24218
A24218
A24247
A24247
A24232
A24232
A24245
A24245
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies