Top » Catalog » SNPs » A24246

$18.00

A24246
[A24246]

A24246
hg38 Position: ChrY:12829319..12829319
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24246_F AATTTGGGAAAGGAAATGATCC
Reverse Primer: A24246_R GTATATGGCTTTCCTTTTGATGAAG
Reviews

Customers who bought this product also purchased
A24226
A24226
A24248
A24248
A24218
A24218
A24247
A24247
A24232
A24232
A24245
A24245
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies