Top » Catalog » SNPs » A24247

$18.00

A24247
[A24247]

A24247
hg38 Position: ChrY:14828363..14828363
Ancestral: A
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24247_F TTTTCATTATCCAAGTTTTTTAGTGTC
Reverse Primer: A24247_R TCACAGCATTCCATTTACGATC
Reviews

Customers who bought this product also purchased
A24218
A24218
A24246
A24246
A24232
A24232
A24245
A24245
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies