Top » Catalog » SNPs » A24248

$18.00

A24248
[A24248]

A24248
hg38 Position: ChrY:15911707..15911707
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24248_F GCTGGTTGAATGAATGATGAAGAG
Reverse Primer: A24248_R CACGACCTGGGATAGAAGTGAC
Reviews

Customers who bought this product also purchased
A24243
A24243
A24249
A24249
A24226
A24226
A24247
A24247
A24218
A24218
A24246
A24246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies