Top » Catalog » SNPs » A24248

$18.00

A24248
[A24248]

A24248
hg38 Position: ChrY:15911707..15911707
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24248_F GCTGGTTGAATGAATGATGAAGAG
Reverse Primer: A24248_R CACGACCTGGGATAGAAGTGAC
Reviews

Customers who bought this product also purchased
A24245
A24245
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Whole Genome Sequence
Whole Genome Sequence
A24243
A24243
A24249
A24249
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies