Top » Catalog » SNPs » A24249

$18.00

A24249
[A24249]

A24249
hg38 Position: ChrY:21638606..21638606
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A24249_F TTAGTGGATCCATTAATTCCAGTG
Reverse Primer: A24249_R AAAAAGGAACTTCCAGGTCTACG
Reviews

Customers who bought this product also purchased
A24246
A24246
A24232
A24232
A24245
A24245
YSEQ-Alpha
YSEQ-Alpha
A24244
A24244
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies