Top » Catalog » SNPs » FT89707

$18.00

FT89707
[FT89707]

FT89707
hg38 Position: ChrY:20741911..20741911
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT89707_F GCCCTACATAACGACGATGG
Reverse Primer: FT89707_R TACAGGCATGAGCCACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies