Top » Catalog » SNPs » Y182215

$18.00

Y182215
[Y182215]

Y182215
hg38 Position: ChrY:16742880..16742880
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: With Y18621
Forward Primer: Y182215_F AAGATTTAACTTGGAGAACCGTGA
Reverse Primer: Y182215_R AGCACTTGTACCTCATAAACACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies