Top » Catalog » SNPs » BY78566

$18.00

BY78566
[BY78566]

BY78566
hg38 Position: ChrY:9312736..9312736
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: With Y20016
Forward Primer: BY78566_F ACTGGAAGGGCAATAAATTTTAAG
Reverse Primer: BY78566_R CATTAACTCATCATGCACATGTG
Reviews

Customers who bought this product also purchased
Y134160
Y134160
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies