Top » Catalog » SNPs » BY198275

$18.00

BY198275
[BY198275]

BY198275
hg38 Position: ChrY:11961004..11961004
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2a
Comments: Below S17250 > PH908
Forward Primer: BY198275_F GGAAGATGACAGTCAGGCACC
Reverse Primer: BY198275_R TTATTGATAAATAGATGATGGAGAATACG
Reviews

Customers who bought this product also purchased
FT277419
FT277419
YP206
YP206
Z16983
Z16983
Z2582
Z2582
M173
M173
BY131900
BY131900
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies