Top » Catalog » SNPs » BY198275

$18.00

BY198275
[BY198275]

BY198275
hg38 Position: ChrY:11961004..11961004
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2a
Comments: Below S17250 > PH908
Forward Primer: BY198275_F GGAAGATGACAGTCAGGCACC
Reverse Primer: BY198275_R TTATTGATAAATAGATGATGGAGAATACG
Reviews

Customers who bought this product also purchased
BY111699
BY111699
Y48599
Y48599
FT355524
FT355524
BY125046
BY125046
FT355750
FT355750
FT277419
FT277419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies