Top » Catalog » SNPs » BY198275

$18.00

BY198275
[BY198275]

BY198275
hg38 Position: ChrY:11961004..11961004
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2a
Comments: Below S17250 > PH908
Forward Primer: BY198275_F GGAAGATGACAGTCAGGCACC
Reverse Primer: BY198275_R TTATTGATAAATAGATGATGGAGAATACG
Reviews

Customers who bought this product also purchased
CTS595
CTS595
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
L181
L181
M223
M223
Y5596
Y5596
PF4609
PF4609
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies