Top » Catalog » SNPs » FGC30630

$18.00

FGC30630
[FGC30630]

FGC30630
hg38 Position: ChrY:7079049..7079049
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30630_F TGTCATGAGGTGGGAGTGAG
Reverse Primer: FGC30630_R TGTTGCAAGTTGTCCCAGAC
Reviews

Customers who bought this product also purchased
FGC30728
FGC30728
FGC30733
FGC30733
FGC30727
FGC30727
FGC30732
FGC30732
R1b-L371 PUGH Panel
R1b-L371 PUGH Panel
FGC30731
FGC30731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies