Top » Catalog » SNPs » FGC30727

$18.00

FGC30727
[FGC30727]

FGC30727
hg38 Position: ChrY:7272293..7272293
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30727_F TAGGGTCAGGGACTTATTTCTTTG
Reverse Primer: FGC30727_R TCACACCCAATTAAGCATATGTCT
Reviews

Customers who bought this product also purchased
FGC30632
FGC30632
FGC30732
FGC30732
FGC30631
FGC30631
FGC30731
FGC30731
FGC30630
FGC30630
FGC30730
FGC30730
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies