Top » Catalog » SNPs » FGC30729

$18.00

FGC30729
[FGC30729]

FGC30729
hg38 Position: ChrY:15443375..15443375
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30729_F GAGCTGAAGGTTCTGGAACTGA
Reverse Primer: FGC30729_R TGTCACAATTGGACAGCTGC
Reviews

Customers who bought this product also purchased
FGC30727
FGC30727
FGC30733
FGC30733
FGC30632
FGC30632
FGC30732
FGC30732
FGC30631
FGC30631
FGC30731
FGC30731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies