Top » Catalog » SNPs » FGC30729

$18.00

FGC30729
[FGC30729]

FGC30729
hg38 Position: ChrY:15443375..15443375
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30729_F GAGCTGAAGGTTCTGGAACTGA
Reverse Primer: FGC30729_R TGTCACAATTGGACAGCTGC
Reviews

Customers who bought this product also purchased
FGC30730
FGC30730
FGC30737
FGC30737
R1b-L371 PUGH Panel
R1b-L371 PUGH Panel
FGC30728
FGC30728
FGC30734
FGC30734
FGC30727
FGC30727
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies