Top » Catalog » SNPs » M2783

$18.00

M2783
[M2783]

M2783
hg38 Position: ChrY:10013074..10013074
Ancestral: A
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: N1c1a1a1a1a
Comments: Below VL29 > L550 > L1025
Forward Primer: M2783_F CATGGCTTTCCTGACTTCTGTTAC
Reverse Primer: M2783_R AATATCTGGATCAAATGCTTATCTTG
Reviews

Customers who bought this product also purchased
BY34734
BY34734
Y17242
Y17242
Y6075
Y6075
BY134916
BY134916
FGC52474
FGC52474
A11932
A11932
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies