Top » Catalog » SNPs » FGC30730

$18.00

FGC30730
[FGC30730]

FGC30730
hg38 Position: ChrY:16593166..16593166
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30730_F GCTACCATGGGAAACGTACTG
Reverse Primer: FGC30730_R AGAAGTTCCATGGCAAAACG
Reviews

Customers who bought this product also purchased
FGC30632
FGC30632
FGC30732
FGC30732
FGC30631
FGC30631
FGC30731
FGC30731
FGC30630
FGC30630
FGC30729
FGC30729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies