Top » Catalog » SNPs » ALK599

$18.00

ALK599
[ALK599]

ALK599
hg38 Position: ChrY:17363440..17363440
Ancestral: G
Derived: A
Reference: Ahmad Al Khuraiji (2018)
ISOGG Haplogroup: J1a
Comments: Below FGC2
Forward Primer: ALK599_F TAAAACAGGGAAGAAAGGAAAGTG
Reverse Primer: ALK599_R AAAGATTATTTTCATTAGCTGTTCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies