Top » Catalog » SNPs » FGC30731

$18.00

FGC30731
[FGC30731]

FGC30731
hg38 Position: ChrY:16863937..16863937
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30731_F GCTAGCCATATGTAGAAAGCTGATATG
Reverse Primer: FGC30731_R CGCCCATATTTGATGGAGTTA
Reviews

Customers who bought this product also purchased
FGC30630
FGC30630
FGC30729
FGC30729
FGC30737
FGC30737
R1b-L371 PUGH Panel
R1b-L371 PUGH Panel
FGC30728
FGC30728
FGC30734
FGC30734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies